Protein – Nucleic Acid Interactions
B-ZIP transcription factors
In collaboration with Dr. Charles Vinson (Laboratory of Metabolism, CCR, NCI) we used fluorescence anisotropy to study the interactions of the basic region leucine zipper (B-ZIP) protein family of transcription factors with short oligonucleotides. Specifically we measured the salt dependent binding of C/EBPβ to an oligonucleotide containing either the C/EBPβ consensus sequence or that of a related B-ZIP protein AP-1. A fluorescein molecule was attached to a thymidine base within each consensus sequence.
This figure shows relatively little change in C/EBPβ in the binding to its consensus sequence (GTCAGTCAGAATTGCGCAAT*ATCGGTCAG where the underlined region is the consensus sequence and the * indicates the position of the fluorescein label) with increasing concentrations of NaCl
This figure shows a significant decrease in the binding of C/EBPβ to an oligonucleotide with the AP1 consensus sequence (GTCAGTCAGAATGACTCAT*ATCGGTCAG where the underlined region is the consensus sequence and the * indicates the position of the fluorescein label) with increasing concentrations of NaCl. At 300mM NaCl no binding is detected.
