INX-3001 c-Myb Antisense oligonucleotide

Reagent:   phosphorothioated antisense oligodeoxynucleotide
Date of Manufacturing:   8/22/2000 (lot# 1330002A); recertified 11/07/2005
NSC #:   710296
Concentration:   0.4 mg/ml @50 mg/vial
Volume:   20 ml/vial
Formulation:   lyophilized powder
Product Description:   INX-30002A is a fully phophorothioated antisense oliogdeoxynucleotide target the c-myb gene.
Sequence:   TATGCTGTGCCGGGGTCTTCGGGC
Product Testing:
PH: 7.5 +/- 1.0   Purity by 31PNMR: >99.8%
Appearance: WHITE POWDER   Sterility: Pass
Endotoxin: Pass   Particulates: 10um < 6000 units
25 um < 600 units
Product Storage:   Store in refrigerator at 20 to 80 C (360 to 460 F)
CAUTION: FOR RESEARCH USE ONLY. NOT FOR DRUG OR DIAGNOSTIC USE. NOT FOR USE IN HUMANS.
NOTE: Recipients of this agent will be required to sign a Material Transfer Agreement. All International Orders are required to pay a packaging and handling fee. All recipients are required to providea a FedEx account number. All recipients are required to pay for shipping.