Frequently Asked Questions

  • Using too much antibiotic for single-copy markers is the most common reason for not seeing any knock-out recombinants. These are the levels we find typically work well. We have found, however, that using the spectinomycin* cassette to knock out genes can be tricky. The concentration of spec needed to allow selection and prevent background growth must be determined for each construct in each strain.

     
    ANTIBIOTIC (µg/ml) SINGLE COPY MULTI-COPY PLASMIDS
    Ampicillin 30 100
    Kanamycin 30 50
    Chloramphenicol 10 20
    Tetracycline 12.5 25
    Spectinomycin 30-100* 100
    Hygromycin 200 200 #
    Blasticidin not determined 50

    # We originally used 50µg/ml hygromycin but found that it gave a high background. We now use 200µg/ml. Hygromycin should be filter-sterilized before addition as the manufacturer does not guarantee sterility. 

  • It is a good idea to have uniformity in what primers are used for drug cassettes. We use the following with good success. For your convenience, you can download this table as a word file called, cassette primers. cassette primers.docx

    Drug Cassette Potential template sources Primer Pair1 Expected product size (bp)
    Ampicillin pBR322 (New England Biolabs) and derivatives 5'_CATTCAAATATGTATCCGCTC
    5'_AGAGTTGGTAGCTCTTGATC
    1202
    Kanamycin pBBR1MCS-2 (Kovach et al., 1994), Tn 5 (Ahmed & Podemski, 1995) Note: this is not the same kanamycin gene as in Tn 903. 5'_TATGGACAGCAAGCGAACCG
    5'_TCAGAAGAACTCGTCAAGAAG
    950
    Chloramphenicol pACYC184 (New England Biolabs) 5'_TGTGACGGAAGATCACTTCG
    5'_ACCAGCAATAGACATAAGCG
    1011
    Tetracycline 1: tetA & tetR Tn 10 (Hillen & Schollmeier, 1983) Note: this is not the same tetracycline gene as in pBR322 or pACYC184. 5'_CAAGAGGGTCATTATATTTCG
    5'_ACTCGACATCTTGGTTACCG
    2016
    Tetracycline 2: tetA2 Tn10 (Hillen & Schollmeier, 1983) Note: this is not the same tetracycline gene as in pBR322 or pACYC184. 5'_CAAGAGGGTCATTATATTTCG
    5’_TCCTAATTTTTGTTGACACTCTA
    1313
    Spectinomycin3 pBBR1MCS-5 (Kovach et al., 1994), DH5λPRO (Clontech) 5'_ACCGTGGAAACGGATGAAGG
    5'_AGGGCTTATTATGCACGCTTAA
    1229
    cat-sacB cassette pK04/pEL04 (Lee et al., 2001) 5'_TGTGACGGAAGATCACTTCG
    5'_ATCAAAGGGAAAACTGTCCATA
    3240
    amp-sacB cassette NC398 (Svenningsen et al., 2005) 5'_CATTCAAATATGTATCCGCTC
    5’_ATCAAAGGGAAAACTGTCCAT
    3129
    tet-sacB cassette T-SACK (Li et al., 2013) 5'_TCCTAATTTTTGTTGACACTCTATC
    5'_ATCAAAGGGAAAACTGTCCATATGC
    3527

    1 The melting temperature (TM) of these primer pairs is 58°-62°C. Thus, an annealing temp of 54°C will work for all of them. All primer pairs are designed to include a transcriptional promoter. For some genes, the endogenous promoter and Shine Delgarno sequence (SD) are strong enough that the orf can be replaced directly with the drug resistance orf.

    2 Only TetA is required for tetracycline resistance. This set of tet primers makes a smaller cassette than the TetA-TetR dual cassette, but it is unregulated.

    3 Using the spectinomycin cassette to knock out genes can be tricky, with the concentration of Spec needed to allow selection and at the same time prevent background growth. This concentration must be determined for each construct and in each strain.

  • If you make the mistake and grow your overnight at too high of a temperature, you should abandon the experiment and start over. Growing the cells at >34° will induce the pL operon which does several things. If you are using a λ prophage containing strain, the kil gene is expressed, which will kill the cells if made for an hour or more. Extended expression of Gam will also kill cells. Thus, there is a strong selection for mutations that prevent expression of pL when cells are grown at elevated temperatures.  Once the pL operon is inactivated, the cells will survive but will be useless for recombination, since Red will not be expressed! There are exceptions: for example, strain SIMD50 does not contain either the gam or kil gene and thus there is no problem. Also, the pSIM plasmids do not contain kil. However, many of the pSIM plasmids have temperature-sensitive replication origins so you may lose your recombineering plasmid if the strain is grown at too high a temperature. The bottom line is, know your cells genotype and what it means! It is always safer to routinely (as we do) grow your recombineering cells at 32°.

  • No, it will not work! It is critical to get the temperature up to 42° as quickly as possible. This cannot be achieved with an air shaker as the heat transfer is inefficient. If you must, you can use an air shaker for the 32° incubations but induction of the Red genes at 42° must be in a water bath, preferably with rapid (200-220rpm) shaking in a baffled flask. No induction = no recombination!

  • Not necessarily, it depends on what they are being used for. We order our oligos from IDT as “salt free” but otherwise unpurified. However, the manufacturers do suggest further purification for long oligos, such as the 70bp ones we use for oligo-mediated recombination. The reason is that during the synthesis of oligos, the coupling reaction is about 99% efficient and thus 1% of oligos do not pick up the proper base. After each step, attempts are made to keep these “mutant” oligos from extending by use of a capping reagent. However, this process is not 100% so some oligos that are missing a given base continue on to the next addition step creating a deletion-containing oligo.  From IDT tech support, a 70mer is 55% full length and 45% truncated/mutated products. That said, in experiments it was shown that about 2% of 82mers contained mutations after recombineering (see Oppenheim reference below*). Further, we normally have a selection for recombinants (e.g. Gal+) so the selection process itself “weeds out” any oligos containing mutations that don’t allow the cells to become Gal+.  If you do not have a selection for the change you are making or the screen is difficult, purification may be worth the added expense. For oligos longer than 50bp, purification should be by PAGE to reach the highest purity as HPLC has been shown to not help much.  PAGE can increase purity to 85-90%.

     

    *Oppenheim, A. B., Rattray, A. J., Bubunenko, M., Thomason, L. C. & Court, D. L. (2004). In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides. Virology 319, 185-189.

  • Our standard induction is 15 minutes.  However, we know that shorter and longer times can work depending on the details of the experiment.  Below it can be seen that with oligo recombination, 5 minutes induction is sufficient for optimal recombination levels.  However with dsDNA recombination, a 10 minute or longer induction time is required. Likewise, long inductions with the Beta-only strain, SIMD50, are ok. This table does not include the data but long induction times of HME6 (and most recombineering strains) results in cell killing if the induction is 60 minutes or longer due to the lambda kil gene.

     
    LENGTH OF INDUCTION (min) SIMD50 HME6
      Gal+ /108 viable 1 Gal+ /108 viable 1 CatR /108 viable 2
    0 3.1x104 1.7x104 2.0x101
    1 9.0x104 1.2x104  
    3 7.5x106 1.2x106 1.4x102
    5 2.0x107 1.5x107 2.1x104
    10 3.2x107 3.1x107 1.2x105
    15 1.6x107 2.8x107 1.3x105
    20 1.2x107 2.6x107 6.4x104
    30 1.2x107 1.6x107 1.1x104
    60 1.1x107    
    overnight (saturated) <2x101    
    Overnight then dilute at 42° 6.2x106    

    1 Recombination with an oligo to correct the galKam to Gal+.

    2 Recombination with a chloramphenicol cassette to knock-out galK. 

  • There can be several causes but the most common are 1) using the wrong drug concentration for single-copy cassettes and 2) losing too many cells during preparation of recombineering- and electroporation-competent cells. Check your drug concentrations under FAQ 1. If your viability counts are very low (<107), this could indicate that electroporation killed a lot of cells or more likely, you lost a lot of them down the sink. The pellet is very soft after the cells are in H2O and care must be taken when decanting.

        Another common problem with not getting recombinants is not allowing enough outgrowth time to allow 1) expression of the drug-resistance gene and 2) segregation of chromosomes (newly made “wildtype” away from ones still containing cat-sacB) if you are doing a counter-selection such as cat-sacB. In both cases, at least a 2-3 hour outgrowth is necessary. See Protocols. 

  • Did you use a plasmid for the template for your drug cassette? If so, more than likely all of your “recombinants” are just transformants that contain the template plasmid. Electroporation is a very efficient transformation method and supercoiled plasmid DNA transforms very well. We recommend not using plasmids as templates for this reason and we use chromosomal templates whenever possible. We have a stain called, “T-SACK”, that is available that can serve as a template for tetA, kan, tet-sacB, amp and cat cassettes. We highly recommend using it as your template. The best source for amplification of the cat-sacB seletion/counter-selection cassette is the bacterial strain TUC01, which is available from the Court laboratory. Although the plasmids pKO4 and pELO4 contain cat-sacB, because they are plasmids, they are problematic as templates. 

  • We use cuvettes with a gap of 0.1 cm and a BioRad Micropulser set to: 1.8 kV, 25 λF, 200 ohms. For optimal results, the time constant should be greater than 5 msec. We see good results, however, whenever they are >4 msec. Others have told us that cuvettes with a 0.2 cm gap do not work.

  • This is most often due to impurities or salts in the cells or the DNA but occasionally can be due to a cracked/defective cuvette or one that is too warm. We often store our cuvettes at -20° so they are ready to use. An arc will result in a low time constant and thus poor or no transformation. When this happens, set up a new electroporation with a fresh chilled cuvette and try again. If the cells or DNA are the problem, you may need to start over or try using less DNA. The DNA should always be diluted in ddH2O to keep salt to a minimum.

  • Yes! The LB we use contains: 5 g yeast extract, 10 g tryptone, and 5 g NaCl for 1 L media. Some recipes use 10 g NaCl. We have seen low viability of cells after electroporation when 10 g of NaCl is used.

  • We recommend that you make a glycerol stock of all strains we send you ASAP. When you receive your strains, take a sterile loop and plunge it into the center of your stab. Good practice is to now streak it out for a single colony on a selective plate. For example if we sent you a strain containing pSIM5, steak out on a L+Cm (20µg/ml) agar plate or if the strain contains no drug resistance, an LB plate will do. Remember to incubate the plate at 32°!  Next grow a liquid culture (at 32°) from a single colony. Include the appropriate antibiotic (concentrations shown in FAQ 1) if the strain contains a plasmid. A glycerol can be made by adding 200µl of 50% glycerol to 700µl of an overnight culture of your strain in a small vial. These should be stored at -70°C. When you need the strain again, use a sterile loop to scrape out a small amount of frozen cells and streak it out for single colonies on an agar plate and incubate at 32°.

  • We send our strains and plasmids out as “stabs”. A stab is a small vial containing nutrient medium like that used to make petri plates. We use a sterile loop to innoculate the stab with the strain you request. The strain can survive for years in such a slant although evolution can occur over time so we recommend that you make a glycerol stock (see FAQ 12). When you receive your strain, simply take a sterile loop and plunge it into the center of your stab. Good practice is to now streak it out for a single colony on a selective plate. For example if we sent you a strain containing pSIM5, steak out on a L+Cm (20µg/ml) agar plate or if the strain contains no drug resistance, an LB plate will do. Remember to incubate the plate at 32°!  In the pSIM5 case, you should next grow a liquid culture (at 32°) from a single colony and make a plasmid prep (mini or midi is fine) so you have a stock of pSIM5 to put into whatever strains you wish. Always remember to make a glycerol stock of the strains we send for long term storage (see FAQ 12).

  • A number of factors can account for problems in obtaining high oligo recombination frequencies, most of which are described in Sawitzke et al., 2011. We find that the final recombination efficiency you get results from the cumulative effect of these different factors, with each making an independent contribution. If one or more of these parameters are not optimal the recombination frequency can be dramatically reduced.  These parameters include:

    1. Problems with DNA uptake.

    2. Using an inappropriate oligo length - we use 70 base oligos or longer.

    3. Attempting reactions other than correcting point mutations or changes of a few bases (i.e. removing a large piece of DNA is not a high efficiency reaction).

    4. Use of a leading-strand oligo rather than a lagging-strand.

    5. Use of too little oligonucleotide, which will be subject to degradation by ss-exonucleases.

    6. Methyl-directed mismatch repair correction of heteroduplex recombination intermediates.

    7. Long outgrowth following electroporation, which reduces the apparent frequency of recombination by about 6- to 10-fold, because it allows complete segregation of the recombinant bacterial chromosome away from its non-recombinant siblings. Also, if the recombinant confers a slow growth phenotype, the mutant will be diluted further.

    8. Problems with expression of Red Beta. While convenient, the plasmids described in Datsenko and Wanner (2000) give ~10-fold fewer recombinants than does the λ prophage. A comparison of the two expression systems is given in Datta et al., 2006.

    9. Use of a recombinase other than Red Beta. Datta et al. (2008) observed ~100-fold fewer recombinants for RecT-mediated oligo recombination than for that mediated by Beta.